Top » Catalog » R1b » A739

$18.00

A739
[A739]

A739
hg38 Position: ChrY:10098947..10098947
Ancestral: T
Derived: C
Reference: Richard Cameron (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k1 (not listed)
Comments: Downstream of S691
Forward Primer: A739_F CCTTCTTGATTTCCTTTTTCACG
Reverse Primer: A739_R TGACTATTGTGCTATGTTTTTGTAACTC
Reviews

Customers who bought this product also purchased
FGC19639
FGC19639
A729
A729
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A390
1 x A569
$36.00
Haplogroup Info
Other products
Currencies