Top » Catalog » R1b » A432

$18.00

A432
[A432]

A432
hg38 Position: ChrY:12787532..12787532
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2a4
Comments: Approx. DF27
Forward Primer: A432_F GGGAAATTTGGATAGTGACTGG
Reverse Primer: A432_R CATGAAGCCCACAATATAAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2226
1 x A2267
1 x A1056
1 x A746
$72.00
Haplogroup Info
Other products
Currencies