Top » Catalog » R1b » A740

$18.00

A740
[A740]

A740
hg38 Position: ChrY:14222233..14222233
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF5 > L1402
Forward Primer: A740_F CTTGACAGTAGTTTGAGGTGCTTC
Reverse Primer: A740_R GGATTATTATGCACTACATCACTGC
Reviews

Customers who bought this product also purchased
A422
A422
DYS713
DYS713
A742
A742
A741
A741
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies