Top » Catalog » R1b » A741

$18.00

A741
[A741]

A741
hg38 Position: ChrY:19130450..19130450
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF5 > L1402
Forward Primer: A741_F CCTCACAAATGTGCCTCCTG
Reverse Primer: A741_R GTTCTGTTTCTAGGGCATAACAGC
Reviews

Customers who bought this product also purchased
A742
A742
A740
A740
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2256
$18.00
Haplogroup Info
Other products
Currencies