Top » Catalog » R1b » A742

$18.00

A742
[A742]

A742
hg38 Position: ChrY:7980194..7980194
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF5 > L1402
Forward Primer: A742_F GTGGCTAGCACTCATACATCACTAC
Reverse Primer: A742_R ATGACAGTAAGGAATGTCATTTTCAC
Reviews

Customers who bought this product also purchased
A741
A741
A740
A740
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A306
1 x A1773
1 x A187
1 x A551
1 x A95
1 x A1322
1 x A410
1 x A975
1 x A135
1 x A359
1 x A510
1 x A337
1 x A629
1 x A467
1 x A1165
1 x A1161
1 x A462
1 x A1495
1 x A927
1 x A1269
$360.00
Haplogroup Info
Other products
Currencies