Top » Catalog » R1b » A744

$18.00

A744
[A744]

A744
hg38 Position: ChrY:8118521..8118521
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A744_F GGCTTGTAAGTTAAGTTTCCTGATTTC
Reverse Primer: A744_R TGACCATGGCTTTGTCTATATTATG
Reviews

Customers who bought this product also purchased
Z2980
Z2980
DF49
DF49
S659
S659
M222
M222
S588
S588
FGC5939.2
FGC5939.2
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A599
1 x A212
$36.00
Haplogroup Info
Other products
Currencies