Top » Catalog » R1b » A745

$18.00

A745
[A745]

A745
hg38 Position: ChrY:8634527..8634527
Ancestral: C
Derived: T
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b2b
Comments: Downstream of A150
Forward Primer: A745_F CAAACTCCCGATTTGAGCAC
Reverse Primer: A745_R GAGAGCCCCTGCAATATGAG
Reviews

Customers who bought this product also purchased
A195
A195
CTS4466
CTS4466
A2221
A2221
FGC29280
FGC29280
A150
A150
A808
A808
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A348
1 x A990
1 x A640
$54.00
Haplogroup Info
Other products
Currencies