Top » Catalog » R1b » A746

$18.00

A746
[A746]

A746
hg38 Position: ChrY:16691162..16691162
Ancestral: G
Derived: A
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b2b
Comments: Downstream of A150
Forward Primer: A746_F TTGTTTTTAAGGAGCTGGTCAAC
Reverse Primer: A746_R TGCATTCATTTTTGGAGCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1147
1 x A909
1 x A1204
1 x A628
$72.00
Haplogroup Info
Other products
Currencies