Top » Catalog » R1b » A747

$18.00

A747
[A747]

A747
hg38 Position: ChrY:16927671..16927671
Ancestral: C
Derived: T
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b2b
Comments: Downstream of A150
Forward Primer: A747_F TGTCAAAAAGTAATGAGAACAGTTGC
Reverse Primer: A747_R TTCCCCGACCTCTTGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies