Top » Catalog » R1b » A752

$18.00

A752
[A752]

A752
hg38 Position: ChrY:19816642..19816642
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A752_F TTAAAGGATCCCACATGTTAGTTAGTAG
Reverse Primer: A752_R TCCCCCAATAACCCATAAGAC
Reviews

Customers who bought this product also purchased
A751
A751
A750
A750
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1752
$18.00
Haplogroup Info
Other products
Currencies