Top » Catalog » R1b » A758

$18.00

A758
[A758]

A758
hg38 Position: ChrY:14881926..14881926
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A758_F TGCTATTGTGAATAGTATGGCAGG
Reverse Primer: A758_R CAAAATCACAATGAGTTACAATCTCC
Reviews

Customers who bought this product also purchased
A760
A760
A759
A759
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A511
1 x A2075
1 x A426
$54.00
Haplogroup Info
Other products
Currencies