Top » Catalog » R1b » A759

$18.00

A759
[A759]

A759
hg38 Position: ChrY:20924982..20924982
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A759_F TGCATCAGCTCCTTTAAAGCA
Reverse Primer: A759_R GATCCGCTGTTCTACAGGAATC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
A760
A760
A758
A758
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies