Top » Catalog » R1b » A760

$18.00

A760
[A760]

A760
hg38 Position: ChrY:20009572..20009572
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A760_F CCTTGGAGATTTATTTCCTTGTTC
Reverse Primer: A760_R TGAGGGTTCTTGGGCAAAG
Reviews

Customers who bought this product also purchased
A759
A759
A758
A758
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A238
$18.00
Haplogroup Info
Other products
Currencies