Top » Catalog » R1b » A760

$18.00

A760
[A760]

A760
hg38 Position: ChrY:20009572..20009572
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A760_F CCTTGGAGATTTATTTCCTTGTTC
Reverse Primer: A760_R TGAGGGTTCTTGGGCAAAG
Reviews

Customers who bought this product also purchased
A759
A759
A758
A758
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A121
1 x A1321
1 x A1544
1 x A2143
1 x A765
1 x A1164
1 x A682
1 x A636
1 x A326
1 x A190
1 x A227
1 x A443
1 x A660
1 x A300
1 x A1223
1 x A20
$288.00
Haplogroup Info
Other products
Currencies