Top » Catalog » R1b » A762

$18.00

A762
[A762]

A762
hg38 Position: ChrY:7047668..7047668
Ancestral: G
Derived: A
Reference: S21607 group (2014)
ISOGG Haplogroup: R1b1a2a1a1 (not listed)
Comments: Downstream S21607
Forward Primer: A762_F CTCCTGCAGGGGAAAACTTC
Reverse Primer: A762_R TGTTGGATTTTCATGTTAAAGCAG
Reviews

Customers who bought this product also purchased
S21607
S21607
FGC35194
FGC35194
R1b-S21607 Panel
R1b-S21607 Panel
A768
A768
A767
A767
A766
A766
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1059
1 x A230
1 x A2234
1 x A431
1 x A521
1 x A741
$108.00
Haplogroup Info
Other products
Currencies