Top » Catalog » R1b » A763

$18.00

A763
[A763]

A763
hg38 Position: ChrY:7427057..7427057
Ancestral: A
Derived: G
Reference: S21607 group (2014)
ISOGG Haplogroup: R1b1a2a1a1 (not listed)
Comments: Downstream S21607
Forward Primer: A763_F TGCACAGACAAGGAGTGGTC
Reverse Primer: A763_R GTACAGCCACACCACAGAGC
Reviews

Customers who bought this product also purchased
S21607
S21607
FGC35194
FGC35194
R1b-S21607 Panel
R1b-S21607 Panel
A768
A768
A767
A767
A766
A766
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1774
$18.00
Haplogroup Info
Other products
Currencies