Top » Catalog » R1b » A765

$18.00

A765
[A765]

A765
hg38 Position: ChrY:8963551..8963551
Ancestral: G
Derived: C
Reference: S21607 group (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c2b3a1a1a1
Comments: Downstream S21607
Forward Primer: A765_F GAGCCACTGTTGATGGCTG
Reverse Primer: A765_R GTCAGCTTTTATTGCTTATACCATG
Reviews

Customers who bought this product also purchased
R1b-S21607 Panel
R1b-S21607 Panel
S21607
S21607
FGC35194
FGC35194
DNA Sample Kit
DNA Sample Kit
A1234
A1234
A753
A753
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies