Top » Catalog » R1b » A765

$18.00

A765
[A765]

A765
hg38 Position: ChrY:8963551..8963551
Ancestral: G
Derived: C
Reference: S21607 group (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c2b3a1a1a1
Comments: Downstream S21607
Forward Primer: A765_F GAGCCACTGTTGATGGCTG
Reverse Primer: A765_R GTCAGCTTTTATTGCTTATACCATG
Reviews

Customers who bought this product also purchased
FGC35194
FGC35194
R1b-S21607 Panel
R1b-S21607 Panel
S21607
S21607
DNA Sample Kit
DNA Sample Kit
A1234
A1234
A753
A753
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A438
$18.00
Haplogroup Info
Other products
Currencies