Top » Catalog » R1b » A766

$18.00

A766
[A766]

A766
hg38 Position: ChrY:9608122..9608122
Ancestral: A
Derived: C
Reference: S21607 group (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c2b3a1a1a
Comments: Downstream S21607, approx. A764
Forward Primer: A766_F TTCTGCGTTTGTCTCACAGG
Reverse Primer: A766_R TTGTGAGCCTCTGAGAGTGG
Reviews

Customers who bought this product also purchased
S21607
S21607
FGC35194
FGC35194
R1b-S21607 Panel
R1b-S21607 Panel
A763
A763
A770
A770
A762
A762
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies