Top » Catalog » R1b » A767

$18.00

A767
[A767]

A767
hg38 Position: ChrY:13876901..13876901
Ancestral: G
Derived: C
Reference: S21607 group (2014)
ISOGG Haplogroup: R1b1a2a1a1 (not listed)
Comments: Downstream S21607
Forward Primer: A767_F CTGGAGGGAGTGTCTTCCAC
Reverse Primer: A767_R TTAGGCTTTGCACAGACAGC
Reviews

Customers who bought this product also purchased
R1b-S21607 Panel
R1b-S21607 Panel
S21607
S21607
FGC35194
FGC35194
A763
A763
A770
A770
A762
A762
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1058
1 x A1069
$36.00
Haplogroup Info
Other products
Currencies