Top » Catalog » R1b » A768

$18.00

A768
[A768]

A768
hg38 Position: ChrY:14113261..14113261
Ancestral: T
Derived: G
Reference: S21607 group (2014)
ISOGG Haplogroup: R1b1a2a1a1 (not listed)
Comments: Downstream S21607
Forward Primer: A768_F TGTGTTGAGAGGAGCTACATGG
Reverse Primer: A768_R CCTGTGCAAAGCAGAGATTG
Reviews

Customers who bought this product also purchased
R1b-S21607 Panel
R1b-S21607 Panel
S21607
S21607
FGC35194
FGC35194
A753
A753
A765
A765
A763
A763
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A907
1 x A62
1 x A71
1 x A214
1 x A119
1 x A700
$108.00
Haplogroup Info
Other products
Currencies