Top » Catalog » R1b » A769

$18.00

A769
[A769]

A769
hg38 Position: ChrY:14445130..14445130
Ancestral: A
Derived: G
Reference: S21607 group (2014)
ISOGG Haplogroup: R1b1a2a1a1 (not listed)
Comments: Downstream S21607
Forward Primer: A769_F GTGACACGGCCATAACTTTG
Reverse Primer: A769_R TTCTCAGCCTGTGGCAATG
Reviews

Customers who bought this product also purchased
FGC35194
FGC35194
R1b-S21607 Panel
R1b-S21607 Panel
S21607
S21607
A766
A766
A765
A765
A763
A763
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies