Top » Catalog » R1b » A772

$18.00

A772
[A772]

A772
hg38 Position: ChrY:8032383..8032383
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A772_F CTTTAGGTCAGTAGGTAAAATCCTTCAC
Reverse Primer: A772_R AACATACTTGAGAGTTGAAACCTCG
Reviews

Customers who bought this product also purchased
A778
A778
A777
A777
A776
A776
A773
A773
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2142
1 x A1314
1 x A164
1 x A1308
1 x A985
1 x A759
1 x A350
1 x A1742
1 x A251
1 x A911
1 x A642
1 x A1539
1 x A1011
1 x A426
1 x A525
1 x A809
1 x A1072
1 x A1142
1 x A571
1 x A1079
1 x A1774
1 x A1274
1 x A726
$414.00
Haplogroup Info
Other products
Currencies