Top » Catalog » R1b » A773

$18.00

A773
[A773]

A773
hg38 Position: ChrY:8720459..8720462
Ancestral: ins
Derived: del
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A773_F CTCAATCTCTCAACGTGTCAAAG
Reverse Primer: A773_R GTTTCCTGGATCTGGCTCAG
Reviews

Customers who bought this product also purchased
A778
A778
A777
A777
A776
A776
A772
A772
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A128
1 x A2164
1 x A1017
1 x A1301
1 x A1101
1 x A1315
1 x A1202
1 x A1286
1 x A473
1 x A233
1 x A822
1 x A89
1 x A1053
1 x A2124
1 x A341
1 x A148
1 x A716
1 x A287
1 x A1052
1 x A526
1 x A519
1 x A979
1 x A2237
$414.00
Haplogroup Info
Other products
Currencies