Top » Catalog » R1b » A774

$18.00

A774
[A774]

A774
hg38 Position: ChrY:8839850..8839850
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF21 > DF6 > A459
Forward Primer: A774_F GGAGTGGTGGAATTTGCTCAC
Reverse Primer: A774_R AAACTGTCTGTTAAGTATCAGCACCA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies