Top » Catalog » R1b » A774

$18.00

A774
[A774]

A774
hg38 Position: ChrY:8839850..8839850
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF21 > DF6 > A459
Forward Primer: A774_F GGAGTGGTGGAATTTGCTCAC
Reverse Primer: A774_R AAACTGTCTGTTAAGTATCAGCACCA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A920
1 x A139
1 x A689
1 x A1162
1 x A808
1 x A1045
1 x A241
1 x A253
1 x A1247
1 x A496
1 x A1371
1 x A810
1 x A573
1 x A737
1 x A2193
1 x A886
1 x A529
1 x A522
1 x A1020
$342.00
Haplogroup Info
Other products
Currencies