Top » Catalog » R1b » A775

$18.00

A775
[A775]

A775
hg38 Position: ChrY:13746863..13746863
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A775_F TGCGTGTGTGTTTTACTCTTGG
Reverse Primer: A775_R GTCATGAACAGAACAGTGTCATCC
Reviews

Customers who bought this product also purchased
A682
A682
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies