Top » Catalog » R1b » A777

$18.00

A777
[A777]

A777
hg38 Position: ChrY:19401487..19401487
Ancestral: ins
Derived: del
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A777_F CAGGCATAAGCCACCACAC
Reverse Primer: A777_R GCTCAGCTTTGTTTCTGTGATG
Reviews

Customers who bought this product also purchased
A778
A778
A776
A776
A773
A773
A772
A772
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1279
1 x A1185
1 x A1197
1 x A1783
1 x A932
$90.00
Haplogroup Info
Other products
Currencies