Top » Catalog » R1b » A446

$18.00

A446
[A446]

A446
hg38 Position: ChrY:15128237..15128237
Ancestral: T
Derived: C
Reference: Paul Mize (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. DF27
Forward Primer: A446_F TTACAAGGCATAACCTCATAAGGT
Reverse Primer: A446_R TCTGTTGACCAGGCTAGTCTTG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Y15850
Y15850
A787
A787
A10951
A10951
A455
A455
A449
A449
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1369
$18.00
Haplogroup Info
Other products
Currencies