Top » Catalog » R1b » A446

$18.00

A446
[A446]

A446
hg38 Position: ChrY:15128237..15128237
Ancestral: T
Derived: C
Reference: Paul Mize (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. DF27
Forward Primer: A446_F TTACAAGGCATAACCTCATAAGGT
Reverse Primer: A446_R TCTGTTGACCAGGCTAGTCTTG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Y15850
Y15850
A787
A787
A455
A455
A10951
A10951
A5580
A5580
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A447
1 x A250
1 x A441
1 x A671
1 x A579
1 x A1169
1 x A760
1 x A747
1 x A1491
$162.00
Haplogroup Info
Other products
Currencies