Top » Catalog » R1b » A568

$18.00

A568
[A568]

A568
hg38 Position: ChrY:17298905..17298905
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1a2b
Comments: .
Forward Primer: A568_F CTCTTTTCATCAACAGTCCATACAC
Reverse Primer: A568_R GTTAGTACTTGTGGTCTACTTCCTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies