Top » Catalog » R1b » A787

$18.00

A787
[A787]

A787
hg38 Position: ChrY:3844746..3844746
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2a (not listed)
Comments: Below DF27
Forward Primer: A787_F AAGCGTAAACGGCAAACAAG
Reverse Primer: A787_R GATGGTTCTTTTGGGAGGTTC
Reviews

Customers who bought this product also purchased
A5581
A5581
A436
A436
A447
A447
A5579
A5579
A435
A435
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A447
1 x A250
1 x A441
1 x A671
1 x A579
1 x A1169
1 x A760
1 x A747
1 x A1491
1 x A1712
$180.00
Haplogroup Info
Other products
Currencies