Top » Catalog » R1b » A788

$18.00

A788
[A788]

A788
hg38 Position: ChrY:12191740..12191740
Ancestral: T
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2a (not listed)
Comments: Below DF27
Forward Primer: A788_F GGAATACAGGTGTGTGCAAAG
Reverse Primer: A788_R CATCTGGTGGAAAAAGAGTCTACC
Reviews

Customers who bought this product also purchased
A5585
A5585
A434
A434
A5584
A5584
R1b-DF27 Rucker Panel
R1b-DF27 Rucker Panel
A5583
A5583
A789
A789
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A737
$18.00
Haplogroup Info
Other products
Currencies