Top » Catalog » R1b » A788

$18.00

A788
[A788]

A788
hg38 Position: ChrY:12191740..12191740
Ancestral: T
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2a (not listed)
Comments: Below DF27
Forward Primer: A788_F GGAATACAGGTGTGTGCAAAG
Reverse Primer: A788_R CATCTGGTGGAAAAAGAGTCTACC
Reviews

Customers who bought this product also purchased
A789
A789
A446
A446
A5586
A5586
A433
A433
A5585
A5585
A434
A434
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2263
1 x A500
1 x A698
1 x A1168
1 x A2242
1 x A877
1 x A1271
1 x A449
1 x A177
1 x A1270
1 x A223
1 x A819
1 x A982
1 x A1367
1 x A2147
1 x A2140
1 x A2135
$306.00
Haplogroup Info
Other products
Currencies