Top » Catalog » R1b » A790

$18.00

A790
[A790]

A790
hg38 Position: ChrY:19822007..19822007
Ancestral: T
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2a (not listed)
Comments: Below DF27
Forward Primer: A790_F AAGTTAACAGCACAATGTCAAGATC
Reverse Primer: A790_R CAGACTCCTCAGTAGCTGGGAC
Reviews

Customers who bought this product also purchased
A10951
A10951
A455
A455
A434
A434
A5581
A5581
A442
A442
A447
A447
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies