Top » Catalog » R1b » A791

$18.00

A791
[A791]

A791
hg38 Position: ChrY:11871363..11871363
Ancestral: G
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Aka ZP96. Approx. L257
Forward Primer: A791_F CACTTGGGCTCTGCTTTTG
Reverse Primer: A791_R GAGAAAAAGTCTGAGTCTGTCACCT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1734
1 x A557
$36.00
Haplogroup Info
Other products
Currencies