Top » Catalog » R1b » A792

$18.00

A792
[A792]

A792
hg38 Position: ChrY:14281156..14281156
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. L257
Forward Primer: A792_F CAATACAATGAATGAGTACATTGGG
Reverse Primer: A792_R AATTGTATGGACAAGACAGGTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A6
$18.00
Haplogroup Info
Other products
Currencies