Top » Catalog » R1b » A793

$18.00

A793
[A793]

A793
hg38 Position: ChrY:14804584..14804584
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. L257
Forward Primer: A793_F AACATCTTGTGGCTGCTTCC
Reverse Primer: A793_R ACCGACATGGGAAAATTGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1147
1 x A909
1 x A1204
1 x A628
1 x A2190
$90.00
Haplogroup Info
Other products
Currencies