Top » Catalog » R1b » A794

$18.00

A794
[A794]

A794
hg38 Position: ChrY:19709922..19709922
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. L257
Forward Primer: A794_F GTTCCAGGACATCCTGCAAG
Reverse Primer: A794_R GTTCCCATACCATCTCTGTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies