Top » Catalog » R1b » A795

$18.00

A795
[A795]

A795
hg38 Position: ChrY:21294220..21294220
Ancestral: C
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. L257
Forward Primer: A795_F AACATGGGGTAAGTGCCATC
Reverse Primer: A795_R TTAGATTTTGGACTTGCACTGAGT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2263
1 x A500
1 x A698
1 x A1168
1 x A2242
1 x A877
1 x A1271
1 x A449
1 x A177
1 x A1270
1 x A223
$198.00
Haplogroup Info
Other products
Currencies