Top » Catalog » R1b » A611

$18.00

A611
[A611]

A611
hg38 Position: ChrY:8542758..8542758
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Aka FGC19603. downstream of CTS6889 / CTS11824
Forward Primer: A611_F TTGACCACTCCCACTGCCT
Reverse Primer: A611_R TCCTAGGCTGCATACTTTATACAGC
Reviews

Customers who bought this product also purchased
CDY
CDY
DYS456
DYS456
DYS426
DYS426
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
DYS607
DYS607
A624
A624
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A634
$18.00
Haplogroup Info
Other products
Currencies