Top » Catalog » R1b » A612

$18.00

A612
[A612]

A612
hg38 Position: ChrY:8587607..8587607
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Aka FGC19604. downstream of CTS6889 / CTS11824
Forward Primer: A612_F ATGACTGGGCAGCTGTATTTC
Reverse Primer: A612_R AGTCACAACAATATAACCACGACAC
Reviews

Customers who bought this product also purchased
A622
A622
A628
A628
A624
A624
A623
A623
A640
A640
R1b-CTS6889 / CTS11824 downstream
R1b-CTS6889 / CTS11824 downstream
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies