Top » Catalog » R1b » A630

$18.00

A630
[A630]

A630
hg38 Position: ChrY:15636099..15636099
Ancestral: A
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Aka FGC19615. downstream of CTS6889 / CTS11824
Forward Primer: A630_F ACAATGATGATGACAACTGTTGC
Reverse Primer: A630_R TCCTTGACCTTCCAAAATGG
Reviews

Customers who bought this product also purchased
A624
A624
A623
A623
A622
A622
A628
A628
A637
A637
A611
A611
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2270
1 x A1299
1 x A1779
1 x A578
1 x A733
1 x A322
1 x A585
1 x A446
1 x A1070
1 x A256
$180.00
Haplogroup Info
Other products
Currencies