Top » Catalog » R1b » A634

$18.00

A634
[A634]

A634
hg38 Position: ChrY:17284307..17284307
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Aka FGC19619. downstream of CTS6889 / CTS11824
Forward Primer: A634_F GGATTGTAGCTGTCACTTCAGAGAC
Reverse Primer: A634_R TCAGTATGTTTTCCTGGATAACTCAG
Reviews

Customers who bought this product also purchased
A642
A642
A612
A612
A629
A629
A637
A637
A611
A611
A627
A627
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A344
$18.00
Haplogroup Info
Other products
Currencies