Top » Catalog » R1b » A634

$18.00

A634
[A634]

A634
hg38 Position: ChrY:17284307..17284307
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Aka FGC19619. downstream of CTS6889 / CTS11824
Forward Primer: A634_F GGATTGTAGCTGTCACTTCAGAGAC
Reverse Primer: A634_R TCAGTATGTTTTCCTGGATAACTCAG
Reviews

Customers who bought this product also purchased
A642
A642
A633
A633
A640
A640
R1b-CTS6889 / CTS11824 downstream
R1b-CTS6889 / CTS11824 downstream
A632
A632
A639
A639
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies