Top » Catalog » R1b » A797

$18.00

A797
[A797]

A797
hg38 Position: ChrY:8868125..8868125
Ancestral: C
Derived: A
Reference: Richard Cameron (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k1a2 (not listed)
Comments: Downstream of S691
Forward Primer: A797_F CTCACACTTGTCAGCCCTCA
Reverse Primer: A797_R AACTCTGAGGCCCGTAAGTG
Reviews

Customers who bought this product also purchased
A796
A796
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A567
$18.00
Haplogroup Info
Other products
Currencies