Top » Catalog » R1b » A799

$18.00

A799
[A799]

A799
hg38 Position: ChrY:19348391..19348391
Ancestral: C
Derived: G
Reference: Edwin Holcombe (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A799_F TTGGTAATATGGGTGTTTAGTGC
Reverse Primer: A799_R TTCCCACCCCTAACCTATGG
Reviews

Customers who bought this product also purchased
FGC19630
FGC19630
A800
A800
A798
A798
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2164
$18.00
Haplogroup Info
Other products
Currencies