Top » Catalog » R1b » A800

$18.00

A800
[A800]

A800
hg38 Position: ChrY:7995417..7995417
Ancestral: C
Derived: T
Reference: Edwin Holcombe (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A800_F AAAGGTTTGGGAAAATCCTG
Reverse Primer: A800_R TGGACAAGTGCTTTCACCAG
Reviews

Customers who bought this product also purchased
FGC19630
FGC19630
A799
A799
A798
A798
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A567
1 x A1327
1 x A2163
1 x A127
1 x A1787
1 x A1285
1 x A802
1 x A70
1 x A2145
1 x A990
1 x A97
1 x A552
1 x A425
1 x A787
1 x A68
$270.00
Haplogroup Info
Other products
Currencies