Top » Catalog » R1b » A801

$18.00

A801
[A801]

A801
hg38 Position: ChrY:12278396..12278397
Ancestral: del
Derived: ins
Reference: Edwin Holcombe (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of CTS6889 / CTS11824
Forward Primer: A801_F AATTCAACAAGGTTGGCAATG
Reverse Primer: A801_R ACCAAGCAAGACCCTGTCTG
Reviews

Customers who bought this product also purchased
A642
A642
A628
A628
A624
A624
A623
A623
A622
A622
R1b-Westbrook
R1b-Westbrook
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1059
1 x A230
1 x A2234
1 x A431
1 x A521
1 x A741
1 x A854
1 x A150
1 x A722
1 x A355
1 x A2191
1 x A524
1 x A723
1 x A884
$252.00
Haplogroup Info
Other products
Currencies