Top » Catalog » R1b » A802

$18.00

A802
[A802]

A802
hg38 Position: ChrY:8607051..8607051
Ancestral: T
Derived: C
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b4a1
Comments: Found in CTS4466 individuals downstream of S1121
Forward Primer: A802_F TGGAGGGTGTCTTTCATTGG
Reverse Primer: A802_R GCATGAACCATGACAACGTC
Reviews

Customers who bought this product also purchased
A808
A808
A804
A804
R1b-FGC11134 Panel (including CTS4466)
R1b-FGC11134 Panel (including CTS4466)
A542
A542
Z17981
Z17981
S1126
S1126
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1721
1 x A1036
1 x A1163
1 x A2155
1 x A113
1 x A1758
1 x A818
1 x A531
1 x A2220
1 x A2139
1 x A35
1 x A749
1 x A1369
1 x A773
1 x A1177
1 x A748
1 x A1303
1 x A1289
1 x A1702
$342.00
Haplogroup Info
Other products
Currencies